Bradford Condon PhD

Bioinformatics, Web & Mobile Development


bioinformatics

Welcome to Tripal Country!

Tripal Logo

Tripal feature annotations might be a little unintuitive, especially for non-biologists. This guide is to solidify my own knowledge of what goes where and why: hopefully it will be helpful to some developers as well.

Read the full post...

Welcome to Tripal Country!

Tripal Logo

This is a short guide to demonstrate how to create new bundle types with Chado storage in Tripal 3. It was originally written as instructions for my Tripal Alchemist module. There is a similar guide on tripal.info which you can also review.

Read the full post...

Tripal Logo

The 2018 Tripal hackathon took place at the Plant & Animal Genomes conference in San Diego January 11th & 12th. I’d post the itinerary and workshop sessions were, but I didn’t take great notes. Instead, I’ll share about the sessions I took part in. Thursday we discussed Controlled Vocabularies in the morning, and Tripal Core issues (generally Tripal 3 issues) in the afternoon. Friday was a general round-table and a Tripal 3 bundles and fields live demo.

Read the full post...

As a Tripal developer, one of the fun things I get to do is contribute not only to the Tripal project, but also other parts of GMOD, the Generic Model Organism Database Project. I attended the January 10th 2018 GMOD hackathon at the Plant and Animal Genome XXVI conference hoping to make a few small changes to Chado, the SQL database schema that HardwoodGenomics uses with Tripal.

GMOD CHADO

Read the full post...

This post is part 10 of a series on bioinformatics file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Discovar

DISCOVAR is a new genome assembler and variant caller developed by the broad institute. As of this writing,it takes as input Illumina reads of length 250 or longer produced on MiSeq or HiSeq 2500. To learn more, read the entire DISCOVAR manual here.

The assembly output

The final output assembly will take the form of OUT_HEAD.final.*, where OUT_HEAD is set by the user. Below let’s assume we’ve set OUT_HEAD to out.

Read the full post...

This post is part 8 of a series on bioinformatics file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 7 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 6 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 5 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 4 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 3 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky. The conference website is hosted here.

General transfer format (GTF), also known as General Feature Format (GFF) 2.0, is the format for transcripts in exercise 4, RNAseq. For more details, please see the ensembl guide to GFF.

Read the full post...

This post is part 2 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky. The conference website is hosted here.

#FastQ sequence format

FASTQ was originally developed by the Wellcome Trust Sanger Institute to bind together FASTA sequences with their respective quality data. It is now the standard for high-throughput sequencing output.

The format

FASTQ is a four-line per sequence format. If it looks like the raw sequence of your read takes up more than four lines, you probably have word-wrapping enabled.

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Read the full post...

UK-BLAST workshop 2016

This tutorial was developed for Dr. Mark Farman at the University of Kentucky for Undergraduate students participating in UK-BLAST. If you are trying to learn how to run applications from the command line but are feeling lost, this guide is for you.

UK-BLAST is a bioinformatics working group for undergraduate researchers. In small labs, students often tackle the bioinformatician role in with little to no technical guidance. The group may not have anyone with a computer science background, or the task may be beyond the skills of current personnel. In these cases, a working group headed by a technical mentor (myself) allows students to bypass some of the pitfalls and headaches associated with learning computer science all alone.

Read the full post...

UK-BLAST workshop 2016

These exercises were developed for Dr. Mark Farman at the University of Kentucky for Undergraduate students participating in UK-BLAST. If you are trying to learn how to run applications from the command line but are feeling lost, this guide is for you.

UK-BLAST is a bioinformatics working group for undergraduate researchers. In small labs, students often tackle the bioinformatician role in with little to no technical guidance. The group may not have anyone with a computer science background, or the task may be beyond the skills of current personnel. In these cases, a working group headed by a technical mentor (myself) allows students to bypass some of the pitfalls and headaches associated with learning computer science all alone.

Read the full post...

For those of you running MacQIIME on OSX El Capitan or higher, you may (like me) find that the MacQIIME executable is no longer in your path.

I was a little confused:I couldn’t find it on my system, although I still had my MacQIIME installation in the default location.  What gives?

Read the full post...