Bradford Condon PhD

Bioinformatics, Web & Mobile Development


bioinformatics

This post is part 10 of a series on bioinformatics file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Discovar

DISCOVAR is a new genome assembler and variant caller developed by the broad institute. As of this writing,it takes as input Illumina reads of length 250 or longer produced on MiSeq or HiSeq 2500. To learn more, read the entire DISCOVAR manual here.

The assembly output

The final output assembly will take the form of OUT_HEAD.final.*, where OUT_HEAD is set by the user. Below let’s assume we’ve set OUT_HEAD to out.

Read the full post...

This post is part 8 of a series on bioinformatics file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 7 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 6 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 5 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 4 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky.

Read the full post...

This post is part 3 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky. The conference website is hosted here.

General transfer format (GTF), also known as General Feature Format (GFF) 2.0, is the format for transcripts in exercise 4, RNAseq. For more details, please see the ensembl guide to GFF.

Read the full post...

This post is part 2 of a series on file formats, written for the 2017 UK-KBRIN Essentials of Next Generation Sequencing Workshop at the University of Kentucky. The conference website is hosted here.

#FastQ sequence format

FASTQ was originally developed by the Wellcome Trust Sanger Institute to bind together FASTA sequences with their respective quality data. It is now the standard for high-throughput sequencing output.

The format

FASTQ is a four-line per sequence format. If it looks like the raw sequence of your read takes up more than four lines, you probably have word-wrapping enabled.

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Read the full post...

UK-BLAST workshop 2016

This tutorial was developed for Dr. Mark Farman at the University of Kentucky for Undergraduate students participating in UK-BLAST. If you are trying to learn how to run applications from the command line but are feeling lost, this guide is for you.

UK-BLAST is a bioinformatics working group for undergraduate researchers. In small labs, students often tackle the bioinformatician role in with little to no technical guidance. The group may not have anyone with a computer science background, or the task may be beyond the skills of current personnel. In these cases, a working group headed by a technical mentor (myself) allows students to bypass some of the pitfalls and headaches associated with learning computer science all alone.

Read the full post...

UK-BLAST workshop 2016

These exercises were developed for Dr. Mark Farman at the University of Kentucky for Undergraduate students participating in UK-BLAST. If you are trying to learn how to run applications from the command line but are feeling lost, this guide is for you.

UK-BLAST is a bioinformatics working group for undergraduate researchers. In small labs, students often tackle the bioinformatician role in with little to no technical guidance. The group may not have anyone with a computer science background, or the task may be beyond the skills of current personnel. In these cases, a working group headed by a technical mentor (myself) allows students to bypass some of the pitfalls and headaches associated with learning computer science all alone.

Read the full post...